Overview
This assignment involves you designing some PCR primers which would help you clone a cDNA of your gene of interest into the pUC18 vector. We will use some of the research you've started in the in-class exercise with your DNA sequence.
Once you have found the boundaries of your gene of interest (start and stop codons), you will design some PCR primers, which will bind to either side of the coding region - ie. they will bind to the untranslated regions of your cDNA sequence.
Go to the GenBank entry for your gene and look for a link that says "Pick Primers" You want primers that will allow you to amplify the whole coding region.
Use the information in the database entry to help you figure out:
The length of your coding region - this will be the minimum size of your product. The "maximum" length will be the full length of the mRNA/cDNA
The beginning and end of the 5' UTR
The beginning and end of the 3' UTR
These will allow you to indicate where you want the software to look for primer sequences
Criteria for PCR primer design:
The primers should be between 16 and 21 nucleotides in length.
They should have a melting temperature between 55°C and 65°C
The primers are designed in pairs to make sure that their melting temperatures are similar (within 2 - 4 °C of each other), and that they're are unlikely to anneal to each other.
The 3' end of each primer should ideally end in a G or a C, and should have at least 2 of the last 3 nucleotides as a C or a G. This is called a GC-clamp and it ensures that the 3' end binds very strongly to the template strand.
Single-nucleotide stretches should be avoided (ie. you should not have "AAAAAA" or "GGGGG" in your primer).
A useful thing to know:
Run your mRNA/cDNA sequence through WebCutter again, but this time identify any enzymes that do not cut your target DNA, and do cut the pUC18 plasmid in the MCS.
Pick two of those enzymes
Add a recognition sequence for one of the enzymes to the 5' end of one of the primers
Add a recognition sequences for the other enzyme to the 5' end of the other primer
Recalculate the Tm of your primer pair.
Once you have found an appropriate set of primers, you will BLAST the primer sequences against the databases to see if it's possible for them to amplify any sequences besides the DNA sequence of interest.
This is especially important for human DNA. This way, if you manage to contaminate the sample with your own DNA, you won't be amplifying unwanted genes.
Once you have completed all the above steps, each group will submit a sheet which includes the following information:
1. The Name of cDNA/mRNA, or the protein it encodes.
2. The Accession number of your mRNA/cDNA sequence (from the GenBank entry)
3. The two primer sequences including restriction enzyme sites.
◦ For example: product length = 1018
Forward primer 1 ACTAGTACCAGCAAGTTGTTTTCTTGC 21 Restriction Site: SpeI
Template 61 ..................... 81
Reverse primer 1 GAATTCTTTAATCCCGAGCGACACCG 20 Restriction Site: EcoRI
Template 1048 .................... 1029
4. Melting temperature calculations for both primers
◦ make sure you include the restriction site nucleotides in the calculations